SARS2 (NM_001145901) Human 3' UTR Clone

CAT#: SC204831

3`UTR clone of seryl-tRNA synthetase 2 mitochondrial (SARS2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SARS2
• Synonyms: mtSerRS; SARS; SARSM; SerRS; SerRSmt; SERS; SYS
• ACCN: NM_001145901
• Insert Size: 332
• Sequence Data:
  Insert Sequence

  >SC204831 3'UTR clone of NM_001145901
  The sequence shown below is from the reference sequence of NM_001145901. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAGCCTGCTGTAAGCTAAGAACCCACCCACAGCAGCCCTCGGGGGTGTCACTGCTTCCTGGAGTTCAG
  GAGACCCCGGACACCTGGGACCTGTGTTGCTGAGCCCGTCCTGACATCTGTGTTCTTCCTGTCAGCTCCA
  CGCCCGGGCCCCTGGACCACGGGGTCCACCTCTCCTCTGTCCTTGCTGCCTCAGAGTCAGTCACTGACCC
  TGTTATCATTGAGGGTCCCAGTGGGAAGCAGGACGTCTGGGCTTTACGGTTCTAGGGACAGGAGAAGCAG
  AGGAAGAGGCTTCCATCCCTCCTTCCTTCTTTCCTCCTACAGTGCTGAGCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001145901.1
• Summary: This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
• Locus ID: 54938