SARS2 (NM_017827) Human 3' UTR Clone

CAT#: SC204832

3`UTR clone of seryl-tRNA synthetase 2 mitochondrial (SARS2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SARS2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SARS2
Synonyms mtSerRS; SARS; SARSM; SerRS; SerRSmt; SERS; SYS
ACCN NM_017827
Insert Size 332
Sequence Data
>SC204832 3'UTR clone of NM_017827
The sequence shown below is from the reference sequence of NM_017827. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCAGCCTGCTGTAAGCTAAGAACCCACCCACAGCAGCCCTCGGGGGTGTCACTGCTTCCTGGAGTTCAG
GAGACCCCGGACACCTGGGACCTGTGTTGCTGAGCCCGTCCTGACATCTGTGTTCTTCCTGTCAGCTCCA
CGCCCGGGCCCCTGGACCACGGGGTCCACCTCTCCTCTGTCCTTGCTGCCTCAGAGTCAGTCACTGACCC
TGTTATCATTGAGGGTCCCAGTGGGAAGCAGGACGTCTGGGCTTTACGGTTCTAGGGACAGGAGAAGCAG
AGGAAGAGGCTTCCATCCCTCCTTCCTTCTTTCCTCCTACAGTGCTGAGCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017827.3
Summary This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Locus ID 54938

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.