PLAUR (NM_001005376) Human 3' UTR Clone

CAT#: SC204851

3`UTR clone of plasminogen activator urokinase receptor (PLAUR) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLAUR"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PLAUR
Synonyms CD87; U-PAR; UPAR; URKR
ACCN NM_001005376
Insert Size 366 bp
Sequence Data
>SC204851 3'UTR clone of NM_001005376
The sequence shown below is from the reference sequence of NM_001005376. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGCTGTGAGGAAGCCCAAGCTACTCATGTATAAATGCCATGTGGAGATAGAGCCCCAGATGTTTCAGCC
ATCTCAGCCCAGGCACCAGACAAGTGGGTGAAGAAGCCACCTTGGACATGTAGCCCCAGCAGATGTGATA
TAGAGAAGAAACAGGAAACTTGGCTATATTAGTTTCCTAGGGCTGCCTGTGATAAATTATTACAAACTTT
ATAAACTAACACATTGTGTGCCTATATCAAAACATCATGGAAGGACAGGCACAGTGGCTCATGCCTGTAG
TCCTAGCACTTTGGGAGGGTGAGAAAGGAAGATCTCTTGAGCTCAGGAGTTCAAGATCAGCCTGGGCAAC
ACAGTGAGACCTCATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001005376.1
Summary 'This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]'
Locus ID 5329

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.