CDA (NM_001785) Human 3' UTR Clone

CAT#: SC204914

3`UTR clone of cytidine deaminase (CDA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDA
• Synonyms: CDD
• ACCN: NM_001785
• Insert Size: 362
• Sequence Data:
  Insert Sequence

  >SC204914 3'UTR clone of NM_001785
  The sequence shown below is from the reference sequence of NM_001785. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGAGGACCTGCAGAAGACCCAGTGACAGCCAGAGAATGCCCACTGCCTGTAACAGCCACCTGGAGAACT
  TCATAAAGATGTCTCACAGCCCTGGGGACACCTGCCCAGTGGGCCCCAGCCCTACAGGGACTGGGCAAAG
  ATGATGTTTCCAGATTACACTCCAGCCTGAGTCAGCACCCCTCCTAGCAACCTGCCTTGGGACTTAGAAC
  ACCGCCGCCCCCTGCCCCACCTTTCCTTTCCTTCCTGTGGGCCCTCTTTCAAAGTCCAGCCTAGTCTGGA
  CTGCTTCCCCATCAGCCTTCCCAAGGTTCTATCCTGTTCCGAGCAACTTTTCTAATTATAAACATCACAG
  AACATCCTGGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001785.2
• Summary: This gene encodes an enzyme involved in pyrimidine salvaging. The encoded protein forms a homotetramer that catalyzes the irreversible hydrolytic deamination of cytidine and deoxycytidine to uridine and deoxyuridine, respectively. It is one of several deaminases responsible for maintaining the cellular pyrimidine pool. Mutations in this gene are associated with decreased sensitivity to the cytosine nucleoside analogue cytosine arabinoside used in the treatment of certain childhood leukemias. [provided by RefSeq, Jul 2008]
• Locus ID: 978