PPAP2A (PLPP1) (NM_003711) Human 3' UTR Clone

CAT#: SC204945

3`UTR clone of phosphatidic acid phosphatase type 2A (PPAP2A) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLPP1
• Synonyms: LLP1a; LPP1; PAP-2a; PAP2; PPAP2A
• ACCN: NM_003711
• Insert Size: 376
• Sequence Data:
  Insert Sequence

  >SC204945 3'UTR clone of NM_003711
  The sequence shown below is from the reference sequence of NM_003711. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACTATCCGAGCAATCACCAGCCTTGAAAGGCAGCAGGGTGCCCAGGTGAAGCTGGCCTGTTTTCTAAAG
  GAAAATGATTGCCACAAGGCAAGAGGATGCATCTTTCTTCCTGGTGTACAAGCCTTTAAAGACTTCTGCT
  GCTGCTATGCCTCTTGGATGCACACTTTGTGTGTACATAGTTACCTTTAACTCAGTGGTTATCTAATAGC
  TCTAAACTCATTAAAAAAACTCCAAGCCTTCCACCAAAACAGTGCCCCACCTGTATACATTTTTATTAAA
  AAAATGTAATGCTTATGTATAAACATGTATGTAATATGCTTTCTATGAATGATGTTTGATTTAAATATAA
  TACATATTAAAATGTATGGGAGAACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003711.2
• Summary: The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in synthesis of glycerolipids and in phospholipase D-mediated signal transduction. This enzyme is an integral membrane glycoprotein that plays a role in the hydrolysis and uptake of lipids from extracellular space. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
• Locus ID: 8611