PPAP2A (PLPP1) (NM_176895) Human 3' UTR Clone

CAT#: SC204947

3`UTR clone of phosphatidic acid phosphatase type 2A (PPAP2A) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLPP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PLPP1
Synonyms LLP1a; LPP1; PAP-2a; PAP2; PPAP2A
ACCN NM_176895
Insert Size 376
Sequence Data
>SC204947 3'UTR clone of NM_176895
The sequence shown below is from the reference sequence of NM_176895. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACTATCCGAGCAATCACCAGCCTTGAAAGGCAGCAGGGTGCCCAGGTGAAGCTGGCCTGTTTTCTAAAG
GAAAATGATTGCCACAAGGCAAGAGGATGCATCTTTCTTCCTGGTGTACAAGCCTTTAAAGACTTCTGCT
GCTGCTATGCCTCTTGGATGCACACTTTGTGTGTACATAGTTACCTTTAACTCAGTGGTTATCTAATAGC
TCTAAACTCATTAAAAAAACTCCAAGCCTTCCACCAAAACAGTGCCCCACCTGTATACATTTTTATTAAA
AAAATGTAATGCTTATGTATAAACATGTATGTAATATGCTTTCTATGAATGATGTTTGATTTAAATATAA
TACATATTAAAATGTATGGGAGAACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_176895.1
Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in synthesis of glycerolipids and in phospholipase D-mediated signal transduction. This enzyme is an integral membrane glycoprotein that plays a role in the hydrolysis and uptake of lipids from extracellular space. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Locus ID 8611

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.