Centrin 3 (CETN3) (NM_004365) Human 3' UTR Clone

CAT#: SC204950

3`UTR clone of centrin EF-hand protein 3 (CDC31 homolog yeast) (CETN3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CETN3
• Synonyms: CDC31; CEN3
• ACCN: NM_004365
• Insert Size: 364 bp
• Sequence Data:
  Insert Sequence

  >SC204950 3'UTR clone of NM_004365
  The sequence shown below is from the reference sequence of NM_004365. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACCAAGAGGAGTTCATTGCTATTATGACTGGTGACATTTAAAGAATTACAAGGATAAACACTAAGAATG
  TTGCAGTTACCATCTTATATTCTATTTTTGTGCCTGGAGCCATGTGAAAAAAACCAACTTAGTTCTTTTA
  TCCTAAAGGACCAAAAATAAGCATCTTATATATCTGTATTTTACTACTGTTAAGTTTCTTTGTATGAACT
  GTGTTGTTAGTACTCAGATAGTTTAGCTTTGTATTTATAATAGAGCTTTTATATAAAGTTTTAAAAATTG
  AATGTGTGATATGTGTTCTTTGAAGGTTTTTTAATTTAACATTTATAGTCACTTTTTAGTGCACACATTT
  TCCAGACTTTCGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004365.2
• Summary: 'The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
• Locus ID: 1070