IDH3B (NM_006899) Human 3' UTR Clone

CAT#: SC205018

3`UTR clone of isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IDH3B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IDH3B
Synonyms RP46
ACCN NM_006899
Insert Size 372 bp
Sequence Data
>SC205018 3'UTR clone of NM_006899
The sequence shown below is from the reference sequence of NM_006899. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAGTCTGTCATCGGTCACCTGCAGACTAAAGGGAGCTAGAGCCCTTTATTTCTTCCAACCTTGCAAGGA
CCACACTCCCCATACCCTTCAGTGCAGTGTACCAGGGAAGAGACCTTGTGCCTCTAAGCAGTGGACCATG
GTCACCTTGCTGGGTAGAGCCTAGGTTGTCCTTGGGCCGGCTTCCTTAGGGGACAGACTGTTGGGTGGTG
ATGGGGATTGTTAGGATGGAGCCCAGGCCACATGGATGATGATGATTCTCCCCCACAGGTTCGAACCTCT
GACATGGGTGGCTATGCTACTTGCCATGACTTCACTGAGGCTGTCATTGCTGCCTTGCCCCACCCATAGG
CCCTGTCCATACCCATGTAAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006899.2
Summary 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]'
Locus ID 3420

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.