C9orf95 (NMRK1) (NM_001127603) Human 3' UTR Clone

CAT#: SC205041

3`UTR clone of chromosome 9 open reading frame 95 (C9orf95) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NMRK1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NMRK1
Synonyms bA235O14.2; C9orf95; NRK1
ACCN NM_001127603
Insert Size 346
Sequence Data
>SC205041 3'UTR clone of NM_001127603
The sequence shown below is from the reference sequence of NM_001127603. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGTTTGCAAGTGACAGCATAAAGACGGAACACAACAAATCCTTCCTGAAGTGAATTAGGAAACTCCAAG
GAGTAATTTAAGAACCTTCACCAAGATACAATGTATACTGTGGTACAATGACAGCCATTGTTTCATATGT
TTGATTTTTATTGCACATGGTTTTCCCAACATGTGGAACAATAAATATCCATGCCAATGGACAGGACTGT
ACCTTAGCAAGTTGCTCCCTCTCCAGGGAGCGCATAGATACAGCAGAGCTCACAGTGAGTCAGAAAGTCT
CCACTTTCTGAACATAGCTCTATAACAATGATTGTCAAACTTTTCTAACTGGAGCTCAGAGTAAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127603.1
Summary Nicotinamide adenine dinucleotide (NAD+) is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP-ribosyl groups used in various reactions. Nicotinic acid and nicotinamide, collectively known as niacin, are the vitamin precursors of NAD+. Nicotinamide riboside kinases, such as NRK1, function to synthesize NAD+ through nicotinamide mononucleotide using nicotinamide riboside as the precursor (Bieganowski and Brenner, 2004 [PubMed 15137942]). [supplied by OMIM, Mar 2008]
Locus ID 54981

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.