LAP3 (NM_015907) Human 3' UTR Clone

CAT#: SC205084

3`UTR clone of leucine aminopeptidase 3 (LAP3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LAP3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LAP3
Synonyms HEL-S-106; LAP; LAPEP; PEPS
ACCN NM_015907
Insert Size 383
Sequence Data
>SC205084 3'UTR clone of NM_015907
The sequence shown below is from the reference sequence of NM_015907. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGTTTCAGTCAAGACAATGCTTAGTTCAGATACTCAAAAATGTCTTCACTCTGTCTTAAATTGGACAGTT
GAACTTAAAAGGTTTTTGAATAAATGGATGAAAATCTTTTAACGGAGACAAAGGATGGTATTTAAAAATG
TAGAACACAATGAAATTTGTATGCCTTGATTTTTTTTTCATTTCACACAAAGATTTATAAAGGTAAAGTT
AATATCTTACTTGATAAGGATTTTTAAGATACTCTATAAATGATTAAAATTTTTAGAACTTCCTAATCAC
TTTTCAGAGTATATGTTTTTCATTGAGAAGCAAAATTGTAACTCAGATTTGTGATGCTAGGAACATGAGC
AAACTGAAAATTACTATGCACTTGTCAGAAACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015907.2
Summary Presumably involved in the processing and regular turnover of intracellular proteins. Catalyzes the removal of unsubstituted N-terminal amino acids from various peptides. [UniProtKB/Swiss-Prot Function]
Locus ID 51056

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.