EWSR1 (NM_001163286) Human 3' UTR Clone

CAT#: SC205107

3`UTR clone of Ewing sarcoma breakpoint region 1 (EWSR1) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "EWSR1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EWSR1
Synonyms bK984G1.4; EWS; EWS-FLI1
ACCN NM_001163286
Insert Size 408 bp
Sequence Data
>SC205107 3'UTR clone of NM_001163286
The sequence shown below is from the reference sequence of NM_001163286. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATAAAGGCGAGCACCGTCAGGAGCGCAGAGATCGGCCCTACTAGATGCAGAGACCCCGCAGAGCTGCAT
TGACTACCAGATTTATTTTTTAAACCAGAAAATGTTTTAAATTTATAATTCCATATTTATAATGTTGGCC
ACAACATTATGATTATTCCTTGTCTGTACTTTAGTATTTTTCACCATTTGTGAAGAAACATTAAAACAAG
TTAAATGGTAGTGTGCGGAGTTTTTTTTTCTTCCTTCTTTTAAAAATGGTTGTTTAAGACTTTAACAATG
GGAACCCCTTGTGAGCATGCTCAGTATCATTGTGGAGAACCAAGAGGGCCTCTTAACTGTAACAATGTTC
ATGGTTGTGATGTTTTTTTTTTTTTTTTAAATAAAATTCCAAATGTTTATAAAGAGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001163286.1
Summary 'This gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The protein includes an N-terminal transcriptional activation domain and a C-terminal RNA-binding domain. Chromosomal translocations between this gene and various genes encoding transcription factors result in the production of chimeric proteins that are involved in tumorigenesis. These chimeric proteins usually consist of the N-terminal transcriptional activation domain of this protein fused to the C-terminal DNA-binding domain of the transcription factor protein. Mutations in this gene, specifically a t(11;22)(q24;q12) translocation, are known to cause Ewing sarcoma as well as neuroectodermal and various other tumors. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and 14. [provided by RefSeq, Jul 2009]'
Locus ID 2130

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.