BCAT2 (NM_001164773) Human 3' UTR Clone

CAT#: SC205118

3`UTR clone of branched chain aminotransferase 2 mitochondrial (BCAT2) transcript variant b for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BCAT2
• Synonyms: BCAM; BCATM; BCT2; PP18
• ACCN: NM_001164773
• Insert Size: 384 bp
• Sequence Data:
  Insert Sequence

  >SC205118 3'UTR clone of NM_001164773
  The sequence shown below is from the reference sequence of NM_001164773. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATCCAGTACGGAATCAGAGCCCACGAGTGGATGTTCCCGGTGTGAAGCTGCAGGCTGTGCTCCAGATCC
  ACCGACCCGTAGCATCTCGTCACGCCAGCACTCGCCTCCCTACCAATGACTCACCTGAAGTGCAATACGA
  AATAAAAGGCCAGCGGGCGGCGTCTGGGTCTCTGGCGCCCCCATGTGGTTGCGACACTCCCAAAGCCGTA
  AGGGCCGACCCAGGCATCTTGGCCCCCAGCCCCTCGTCGCGGGTTCAGGTCCGCCCATTACTCCTTGTCG
  TGCGGTCAAGGATACACCTTGGCCCCGATTCCGGATCTCTCCGTTCTCAGGCCAGACCCCTGGTGCTGCC
  GTTGATTTTTTTTTCTCTGTCTTTGCTGCAATTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001164773.1
• Summary: 'This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]'
• Locus ID: 587