SULT1A4 (NM_001017389) Human 3' UTR Clone

CAT#: SC205199

3`UTR clone of sulfotransferase family cytosolic 1A phenol-preferring member 4 (SULT1A4) transcript variant 1

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SULT1A4
• Synonyms: aryl sulfotransferase; phenol sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
• ACCN: NM_001017389
• Insert Size: 400
• Sequence Data:
  Insert Sequence

  >SC205199 3'UTR clone of NM_001017389
  The sequence shown below is from the reference sequence of NM_001017389. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGGGGCTCCTGGAGTCACTGCA
  GAGGGAGTGTGCGAATCTACCCTGACCAATGGGCTCAAGAATAAAGTATGATTTTTGAGTCAGGCACAGT
  GGCTCATGTCTGCAATCCCAGCGATTTGGGAGGTTGAGCTGGTAGGATCACAATAGGCCACGAATTTGAG
  ACCAGCCTGGTAAAATAGTGAGACCTCATCTCTACAAAGATGTAAAAAAATTAGCCACATGTGCTGGCAC
  TTACCTGTAGTCCCAGCTACTTGGGAAGCAGAGGCTGGAGGATCATTTCAGCCCAGGAGGTTGTGGATAC
  AGTGAGTTATGACATGCCCATTCACTACAGCCTGGATGACAAGCAAGACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001017389.1
• Summary: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
• Locus ID: 445329