MADCAM1 (NM_130762) Human 3' UTR Clone

CAT#: SC205208

3`UTR clone of mucosal vascular addressin cell adhesion molecule 1 (MADCAM1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MADCAM1
• Synonyms: MACAM1
• ACCN: NM_130762
• Insert Size: 384
• Sequence Data:
  Insert Sequence

  >SC205208 3'UTR clone of NM_130762
  The sequence shown below is from the reference sequence of NM_130762. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAGGTCGGGATCAGCCCCTCCTGAGTGGCCAGCCTTTCCCCCTGTGAAAGCAAAATAGCTTGGACCCC
  TTCAAGTTGAGAACTGGTCAGGGCAAACCTGCCTCCCATTCTACTCAAAGTCATCCCTCTGTTCACAGAG
  ATGGATGCATGTTCTGATTGCCTCTTTGGAGAAGCTCATCAGAAACTCAAAAGAAGGCCACTGTTTGTCT
  CACCTACCCATGACCTGAAGCCCCTCCCTGAGTGGTCCCCACCTTTCTGGACGGAACCACGTACTTTTTA
  CATACATTGATTCATGTCTCACGTCTCCCTAAAAATGCGTAAGACCAAGCTGTGCCCTGACCACCCTGGG
  CCCCTGTCGTCAGGACCTCCTGAGGCTTTGGCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_130762.2
• Summary: The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
• Locus ID: 8174