SPI1 (NM_003120) Human 3' UTR Clone

CAT#: SC205225

3`UTR clone of spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SPI1
• Synonyms: OF; PU.1; SFPI1; SPI-1; SPI-A
• ACCN: NM_003120
• Insert Size: 357
• Sequence Data:
  Insert Sequence

  >SC205225 3'UTR clone of NM_003120
  The sequence shown below is from the reference sequence of NM_003120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACCCGCCCCACTGAGCCCGCAGCCCCCGCCGGGCCCCGCCAGGCCTCCCCGCTGGCCATAGCATTAAG
  CCCTCGCCCGGCCCGGACACAGGGAGGACGCTCCCGGGGCCCAGAGGCAGGACTGTGGCGGGCCGGGCCT
  CGCCTCACCCGCCCCCTCCCCCCACTCCAGGCCCCCTCCACATCCCGCTTCGCCTCCCTCCAGGACTCCA
  CCCCGGCTCCCGGACGCCAGCTGGGCGTCAGACCCCACCGGGGCAACCTTGCAGAGGACGACCCGGGGTA
  CTGCCTTGGGAGTCTCAAGTCCGTATGTAAATCAGATCTCCCCTCTCACCCCTCCCACCCATTAACCTCC
  TCCCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003120.2
• Summary: This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 6688