SPI1 (NM_001080547) Human 3' UTR Clone

CAT#: SC205226

3`UTR clone of spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "SPI1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SPI1
Synonyms OF; PU.1; SFPI1; SPI-1; SPI-A
ACCN NM_001080547
Insert Size 357
Sequence Data
>SC205226 3'UTR clone of NM_001080547
The sequence shown below is from the reference sequence of NM_001080547. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCACCCGCCCCACTGAGCCCGCAGCCCCCGCCGGGCCCCGCCAGGCCTCCCCGCTGGCCATAGCATTAAG
CCCTCGCCCGGCCCGGACACAGGGAGGACGCTCCCGGGGCCCAGAGGCAGGACTGTGGCGGGCCGGGCCT
CGCCTCACCCGCCCCCTCCCCCCACTCCAGGCCCCCTCCACATCCCGCTTCGCCTCCCTCCAGGACTCCA
CCCCGGCTCCCGGACGCCAGCTGGGCGTCAGACCCCACCGGGGCAACCTTGCAGAGGACGACCCGGGGTA
CTGCCTTGGGAGTCTCAAGTCCGTATGTAAATCAGATCTCCCCTCTCACCCCTCCCACCCATTAACCTCC
TCCCAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001080547.1
Summary This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 6688

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.