TAP1 (NM_000593) Human 3' UTR Clone

CAT#: SC205275

3`UTR clone of transporter 1 ATP-binding cassette sub-family B (MDR/TAP) (TAP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAP1
• Synonyms: ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1*0102N; TAP1N
• ACCN: NM_000593
• Insert Size: 366 bp
• Sequence Data:
  Insert Sequence

  >SC205275 3'UTR clone of NM_000593
  The sequence shown below is from the reference sequence of NM_000593. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCTGCAGATGCTCCAGAATGAAAGCCTTCTCAGACCTGCGCACTCCATCTCCCTCCCTTTTCTTCTCTC
  TGTGGTGGAGAACCACAGCTGCAGAGTAGGCAGCTGCCTCCAGGATGAGTTACTTGAAATTTGCCTTGAG
  TGTGTTACCTCCTTTCCAAGCTCCTCGTGATAATGCAGACTTCCTGGAGTACAAACACAGGATTTGTAAT
  TCCTTACTGTAACGGAGTTTAGAGCCAGGGCTGATGCTTTGGTGTGGCCAGCACTCTGAAACTGAGAAAT
  GTTCAGAATGTACGGAAAGATGATCAGCTATTTTCAACATAACTGAAGGCATATGCTGGCCCATAAACAC
  CCTGTAGGTTCTTGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000593.5
• Summary: 'The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]'
• Locus ID: 6890