PGD (NM_002631) Human 3' UTR Clone

CAT#: SC205308

3`UTR clone of phosphogluconate dehydrogenase (PGD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGD
• Synonyms: 6PGD
• ACCN: NM_002631
• Insert Size: 386 bp
• Sequence Data:
  Insert Sequence

  >SC205308 3'UTR clone of NM_002631
  The sequence shown below is from the reference sequence of NM_002631. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCGTCATACAATGCCTGATCATGCTGCTCCTGTCACCCTCCACGATTCCACAGACCAGGACATTCCAT
  GTGCCTCATGGCACTGCCACCTGGCCCTTTGCCCTATTTTCTGTTCAGTTTTTTAAAAGTGTTGTAAGAG
  ACTCCTGAGGAAGACACACAGTTTATTTGTAAAGTAGCTCTGTGAGAGCCACCATGCCCTCTGCCCTTGC
  CTCTTGGGACTGACCAGGAGCTGCTCATGTGCGTGAGAGTGGGAACCATCTCCTTGCGGCAGTGGCTTCC
  GCGTGCCCCGTGTGCTGGTGCGGTTCCCATCACGCAGACAGGAAGGGTGTTTGCGCACTCTGATCAACTG
  GAACCTCTGTATCATGCGGCTGAATTCCCTTTTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002631.2
• Summary: '6-phosphogluconate dehydrogenase is the second dehydrogenase in the pentose phosphate shunt. Deficiency of this enzyme is generally asymptomatic, and the inheritance of this disorder is autosomal dominant. Hemolysis results from combined deficiency of 6-phosphogluconate dehydrogenase and 6-phosphogluconolactonase suggesting a synergism of the two enzymopathies. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]'
• Locus ID: 5226