ARSG (NM_014960) Human 3' UTR Clone

CAT#: SC205316

3`UTR clone of arylsulfatase G (ARSG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARSG
• Synonyms: KIAA1001
• ACCN: NM_014960
• Insert Size: 388
• Sequence Data:
  Insert Sequence

  >SC205316 3'UTR clone of NM_014960
  The sequence shown below is from the reference sequence of NM_014960. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGCTGTCAAGCCGCATAACAGACCAATTTTTATTCCACGAGGAGGAGTACCTGGAAATTAGGCAAGTTTG
  CTTCCAAATTTCATTTTTACCCTCTTTACAAACACACGCTTTAGTTTAGTCTTGGAGTTTAGTTTTGGAG
  TTAGCCTTGCATATCCCTTCTGTATCCTGTCCCTCCTCCACGCCGACCCGAGAGCAGCTGAGCTGCGCTG
  GCTCTGGGCAGGGAGTGTGCCTTAATGGGAAGCACACGGGCTTTGGAGTCAGGCACAGGTGCCAGCTCCA
  GCTTTTGAACTTGGGCAATTGTTTAACCTAACCTGCAAGTTGATTTTGAGGGTTAAATAAAGGCATACAT
  GAAAATGCCTGGCAAATTACCTGACACAGAGCAGACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014960.3
• Summary: The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
• Locus ID: 22901