MAD3 (MXD3) (NM_031300) Human 3' UTR Clone

CAT#: SC205385

3`UTR clone of MAX dimerization protein 3 (MXD3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MXD3
• Synonyms: BHLHC13; MAD3; MYX
• ACCN: NM_031300
• Insert Size: 426
• Sequence Data:
  Insert Sequence

  >SC205385 3'UTR clone of NM_031300
  The sequence shown below is from the reference sequence of NM_031300. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGGAGCACAGCTACTCGCACGGCGGCGGCGCCTGGCTATGATGTTCCTCACCCAGGGCGGGCCTCTGC
  CCTCTACTCGTGCCAGGCCCACTTGCCAGGCAGGAGCCCTCCCCAAGCCTTCAGGGCTGCTCGGAGTCAC
  CTGTTGGAATGGACTAAAAGGACCCTTGTGTGGGAACAGGTGCTCCCCAAACACCCTGCTGCTGGCTGCC
  AGGCAGGCCCTCTGGAAGGGAAGGGGCAGGACTCATCAGGACCTCCCTGGACCCCTGCAGGGCAGGCAGC
  TTGGGCCCGAGCCCAAGCATTTGGCTCTGCTGCCCCCAAGGGGACAGGAAGCCTCTTGGGCCTCTTCCCT
  TCCTGGACAAGGCCCCCTGCCTTTGCCTCACATAAACTGTACAGTATTTTCATTAAAAGCCTCTTTCATA
  ACTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_031300.3
• Summary: This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
• Locus ID: 83463