Chk1 (CHEK1) (NM_001114121) Human 3' UTR Clone

CAT#: SC205407

3`UTR clone of CHK1 checkpoint homolog (S. pombe) (CHEK1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHEK1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CHEK1
Synonyms CHK1
ACCN NM_001114121
Insert Size 365
Sequence Data
>SC205407 3'UTR clone of NM_001114121
The sequence shown below is from the reference sequence of NM_001114121. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGATGGAGTT
TCACTCTTGTCTCCCAGGCTGGAGTACAATGGCATGATCTCAGCTTACTGCAACCTCCGTCTCCTGGGTT
CAAGCGATTCTCCTGCCTCAGCCTTCCAAGTAGCTGGGATTACAGGTGCCCACCACCACACCTGGCTAGG
TTTTGTATTTTTAGTAGAGATGGGGTTTTTTCATGTTGGCCAGGCTGATCTGGAACTCCTGACCTCAAGT
GATCCACCTGCCTTGGCCTCCCAAAGTGCTGGGATTTTAGGTGTGAGCCACCTCGCCTGGCAAGGGATTC
TGTTCTTAGTCCTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001114121.1
Summary The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 1111

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.