MTHFD1L (NM_015440) Human 3' UTR Clone

CAT#: SC205477

3`UTR clone of methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MTHFD1L
• Synonyms: dJ292B18.2; FTHFSDC1; MTC1THFS
• ACCN: NM_015440
• Insert Size: 422
• Sequence Data:
  Insert Sequence

  >SC205477 3'UTR clone of NM_015440
  The sequence shown below is from the reference sequence of NM_015440. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTTGATACCGAAACAGAACAAGTTAAAGGCTTGTTCTAAGTGGACAAGGCTCTCACAGGACCCGATGCA
  GACTCCTGAAACAGACTACTCTTTGCCTTTTTGCTGCAGTTGGAGAAGAAACTGAATTTGAAAAATGTCT
  GTTATGCAATGCTGGAGACGTGGTGAAATAGGCCAAAGATTTCTTCTTCGTTCAAGATGAATTCTGTTCA
  CAGTGGAGTATGGTGTTCGGCAAAAGGACCTCCACCAAGACTGAAAGAAACTAATTTATTTCTGTTTCTG
  TGGAGTTTCCATTATTTCTACTGCTTACACTTTAGAATGTTTATTTTATGGGGACTAAGGGATTAGGAGT
  GTGAACTAAAAGGTAACATTTTCCACTCTCAAGTTTTCTACTTTGTCTTTGAACTGAAAATAAACATGGA
  TC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015440.3
• Summary: The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
• Locus ID: 25902