KLF7 (NM_003709) Human 3' UTR Clone

CAT#: SC205480

3`UTR clone of Kruppel-like factor 7 (ubiquitous) (KLF7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KLF7
• Synonyms: UKLF
• ACCN: NM_003709
• Insert Size: 430
• Sequence Data:
  Insert Sequence

  >SC205480 3'UTR clone of NM_003709
  The sequence shown below is from the reference sequence of NM_003709. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCCAGGTCTGACCATCTTGCCCTCCACATGAAGAGACATATCTAAAAAACCGAAAGGCCAGAGTTGCCA
  TGGCATCGGCTAGTGTCTAAAGGAAACGCCATGAGGCAGGGGGCTGGACTTCAGGCGGGGACCCATTGCC
  TCGCAGAAGAAAGCTCTCACTTATAAACCTCTGTACACACACACACACACACACACATATACACACACTC
  ACAGACCCACACACATACACACTGTCATGCACTCAACTATATTTAAAATATATACGTCTATTCTTTATGC
  CTTGCCCTAGCCAGATGGAAGAAGATGAAGAAGGAAACCAGGTGAACTCAGCAAGGCAGACTGGCTGCTT
  ACTTCAGCACTATTGGAATTATTTCCCGCTGTTGCCAATGGAAATCAAAGAAAATGGATGTGACGTCTGT
  GCAGGTGGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003709.2
• Summary: The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
• Locus ID: 8609