Germinal Center Kinase (MAP4K2) (NM_004579) Human 3' UTR Clone

CAT#: SC205489

3`UTR clone of mitogen-activated protein kinase kinase kinase kinase 2 (MAP4K2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP4K2
• Synonyms: BL44; GCK; RAB8IP
• ACCN: NM_004579
• Insert Size: 413
• Sequence Data:
  Insert Sequence

  >SC205489 3'UTR clone of NM_004579
  The sequence shown below is from the reference sequence of NM_004579. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAACCTCTACATCCTCACGGGCCACCAGAGCACCTACTAAGAGCAGCGGGCCTGTCCAGGGGCTCCCCG
  CCCCACCCCACGCCTTAGCTGCAGGCCCTTTTGGGCAAAGGGGCCCATCCTAGACCAGAGGAGCCCAGGC
  CCTGGCCCTGCTGGGGCTGAAGGTCAGAAGTAATCCTGAGAAATGTTTCAGGCCTGGGGAGGGAGGGGAG
  CCCCCGACGCCTCTGCAATAACTGGACCAGGGGGAGCTGCTGTCACTCCCCCATCCCCGAGGCAGCCCAG
  TCCCTAGTGCCCAAGGCAGGGACCCTGGGCCTGGGCCATCCATTCCATTTTGTTCCACATTTCCTTTCTA
  CTCTTTCTGCCAAGAGCCTGCCCCTGCATTTGTCCTGGGAAACACGGTATTTAAGAGAGAACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004579.2
• Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
• Locus ID: 5871