HSP70-1B (HSPA1B) (NM_005346) Human 3' UTR Clone

CAT#: SC205504

3`UTR clone of heat shock 70kDa protein 1B (HSPA1B) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSPA1B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSPA1B
Synonyms HSP70-1; HSP70-1B; HSP70-2; HSP70.1; HSP70.2; HSP72; HSPA1; HSX70
ACCN NM_005346
Insert Size 398 bp
Sequence Data
>SC205504 3'UTR clone of NM_005346
The sequence shown below is from the reference sequence of NM_005346. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATTGAGGAGGTGGATTAGGGGCCTTTGTTCTTTAGTATGTTTGTCTTTGAGGTGGACTGTTGGGACTC
AAGGACTTTGCTGCTGTTTTCCTATGTCATTTCTGCTTCAGCTCTTTGCTGCTTCACTTCTTTGTAAAGT
TGTAACCTGATGGTAATTAGCTGGCTTCATTATTTTTGTAGTACAACCGATATGTTCATTAGAATTCTTT
GCATTTAATGTTGATACTGTAAGGGTGTTTCGTTCCCTTTAAATGAATCAACACTGCCACCTTCTGTACG
AGTTTGTTTGTTTTTTTTTTTTTTTTTTTTTTTTGCTTGGCGAAAACACTACAAAGGCTGGGAATGTATG
TTTTTATAATTTGTTTATTTAAATATGAAAAATAAAATGTTAAACTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005346.4
Summary 'This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008]'
Locus ID 3304

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.