LSM2 (NM_021177) Human 3' UTR Clone

CAT#: SC205505

3`UTR clone of LSM2 homolog U6 small nuclear RNA associated (S. cerevisiae) (LSM2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LSM2
• Synonyms: C6orf28; G7B; snRNP; YBL026W
• ACCN: NM_021177
• Insert Size: 376
• Sequence Data:
  Insert Sequence

  >SC205505 3'UTR clone of NM_021177
  The sequence shown below is from the reference sequence of NM_021177. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACAGGATGCGGCAAGGAAGGAAGCCCTGCAGCAGAAACAGTGATGGCTCCTCCTCCTCTTCCCCTCCCT
  CTTTCATTGGTGACCCATAACCCCAAGTCCCAGCCCAGAACCCCTAACCCCCAATACTTGAAGGGGTTTT
  GTTTTTTTACTAATGATGGTTTTGTGGGTTTTTTTTAAGGGATGAGTGGATGAGAGGAGTAATAGGGAAC
  AGCTATCCTCTCTTGAGAAGGGGAGGATAAGTAGGCTGGGAAACTTCAAAGCCTTCCCAGTCCCCAGCAC
  CTGCCTTTCTCACTACTTCTCTGGAGATGGTAGGAGAGTTTCCTAGGTCTTTCCAGGGCAGCATGTGATT
  CATTTGGGGATGGAAGGAATCTGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_021177.3
• Summary: This gene encodes a member of the LSm family of RNA-binding proteins. LSm proteins form stable heteromers that bind specifically to the 3'-terminal oligo(U) tract of U6 snRNA and may play a role in pre-mRNA splicing by mediating U4/U6 snRNP formation. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 19. [provided by RefSeq, Nov 2011]
• Locus ID: 57819