Glutathione Synthetase (GSS) (NM_000178) Human 3' UTR Clone

CAT#: SC205551

3`UTR clone of glutathione synthetase (GSS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSS
• Synonyms: GSHS; HEL-S-64p; HEL-S-88n
• ACCN: NM_000178
• Insert Size: 403 bp
• Sequence Data:
  Insert Sequence

  >SC205551 3'UTR clone of NM_000178
  The sequence shown below is from the reference sequence of NM_000178. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGGCAGTCCTGGACAACCCATACCCTGTGTGAGGGCACAACCAGGCCACGGGACCTTCTATCCTCTGT
  ATTTGTCATTCCTCTCCTAGCCCTCCTGAGGGGTATCCTCCTAAAGACCTCCAAAGTTTTTATGGAAGGG
  TAAATACTGGTACCTTCCCCCAGCTTTCCATCTGAGGACCAGAAAAGTTGTGTCTCCCTTAGATGAGATC
  TAGACGCCCCCAAATCCTTGAGATGTGGGTATAGCTCAGGGTAAGCTGCTCTGAGGTAAAGGTCCATGAA
  CCCTGCCCCACTCCTGTCAGCCCCTCATCAGCCTTTTCAGCAGGTTCCAGTGCCTGACTTGGGATAGGAC
  TGAGTGGTAGGAGGAGGGGGAGTGGAGGGGCATAGCCTTTCCCTAATTCTGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000178.2
• Summary: 'Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]'
• Locus ID: 2937