LSS (NM_001001438) Human 3' UTR Clone

CAT#: SC205567

3`UTR clone of lanosterol synthase (23-oxidosqualene-lanosterol cyclase) (LSS) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LSS
• Synonyms: APMR4; CTRCT44; HYPT14; OSC
• ACCN: NM_001001438
• Insert Size: 426 bp
• Sequence Data:
  Insert Sequence

  >SC205567 3'UTR clone of NM_001001438
  The sequence shown below is from the reference sequence of NM_001001438. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACCCTGAGAGAGCCCTTGCTGGCCACCCCTGAGAACATGCCTACCTGCTGGGTGCCGTCTGTGCGTTCC
  ATGGCCTTCAAGTCACAGGACGCAGCGATTCCCTGCCCTCTTCGGTGTTATTACACAGGCAGGACTTCAG
  TGTCAGTATCCCTGCCTTCAGTCTTCTTTAGAAATCACATCTGTGTTCAATCCATTGTTTAGAGGGAGTG
  TATTTTTCCTGTTCCACGAAGAGGACTTTTTGTTCACAATTGGATCACAATGCAGAGGAGTCTGTTCCTC
  CCCCGTCGGCTTCTCGGTGCTGGGAGGGTGACCTGTCCCAGATGACTCATCACCCTGACATGCTCTTGAC
  AAAGGACACCACCAAGAGGAGATGGCAGCTGTACCGGTGCAGCCTCTGTCTGAGGGGGATATTTGCCTCA
  GTGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001001438.2
• Summary: 'The protein encoded by this gene catalyzes the conversion of (S)-2,3 oxidosqualene to lanosterol. The encoded protein is a member of the terpene cyclase/mutase family and catalyzes the first step in the biosynthesis of cholesterol, steroid hormones, and vitamin D. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2009]'
• Locus ID: 4047