C1S (NM_201442) Human 3' UTR Clone

CAT#: SC205666

3`UTR clone of complement component 1 s subcomponent (C1S) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C1S
Synonyms EDSPD2
ACCN NM_201442
Insert Size 385 bp
Sequence Data
>SC205666 3'UTR clone of NM_201442
The sequence shown below is from the reference sequence of NM_201442. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TATGCAGGAAAATAGCACCCCCCGTGAGGACTAATCCAGATACATCCCACCAGCCTCTCCAAGGGTGGTG
ACCAATGCATTACCTTCTGTTCCTTATGATATTCTCATTATTTCATCATGACTGAAAGAAGACACGAGCG
AATGATTTAAATAGAACTTGATTGTTGAGACGCCTTGCTAGAGGTAGAGTTTGATCATAGAATTGTGCTG
GTCATACATTTGTGGTCTGACTCCTTGGGGTCCTTTCCCCGGAGTACCTATTGTAGATAACACTATGGGT
GGGGCACTCCTTTCTTGCACTATTCCACAGGGATACCTTAATTCTTTGTTTCCTCTTTACCTGTTCAAAA
TTCCATTTACTTGATCATTCTCAGTATCCACTGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_201442.2
Summary 'This gene encodes a serine protease, which is a major constituent of the human complement subcomponent C1. C1s associates with two other complement components C1r and C1q in order to yield the first component of the serum complement system. Defects in this gene are the cause of selective C1s deficiency. [provided by RefSeq, Mar 2009]'
Locus ID 716

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.