ATP6V1H (NM_213620) Human 3' UTR Clone

CAT#: SC205682

3`UTR clone of ATPase H+ transporting lysosomal 50/57kDa V1 subunit H (ATP6V1H) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6V1H
• Synonyms: CGI-11; MSTP042; NBP1; SFD; SFDalpha; SFDbeta; VMA13
• ACCN: NM_213620
• Insert Size: 433
• Sequence Data:
  Insert Sequence

  >SC205682 3'UTR clone of NM_213620
  The sequence shown below is from the reference sequence of NM_213620. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCAGTCCGAGCAGCCCCAGACCGCTGCCGCCCGAAGCTAAGCCTGCCTCTGGCCTTCCCCTCCGCCTC
  AATGCAGAACCAGTAGTGGGAGCACTGTGTTTAGAGTTAAGAGTGAACACTGTTTGATTTTACTTGGAAT
  TTCCTCTGTTATATAGCTTTTCCCAATGCTAATTTCCAAACAACAACAACAAAATAACATGTTTGCCTGT
  TAAGTTGTATAAAAGTAGGTGATTCTGTATTTAAAGAAAATATTACTGTTACATATACTGCTTGCAATTT
  CTGTATTTATTGTTCTCTGGAAATAAATATAGTTATTAAAGGATTCTCACTCCAAACATGGCCTCTCTCT
  TTACTTGGACTTTGAACAAAAGTCAACTGTTGTCTCTTTTCAAACCAAATTGGGAGAATTGTTGCAAAGT
  AGTGAATGGCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_213620.1
• Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
• Locus ID: 51606