ATP6V1H (NM_015941) Human 3' UTR Clone

CAT#: SC205683

3`UTR clone of ATPase H+ transporting lysosomal 50/57kDa V1 subunit H (ATP6V1H) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP6V1H"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP6V1H
Synonyms CGI-11; MSTP042; NBP1; SFD; SFDalpha; SFDbeta; VMA13
ACCN NM_015941
Insert Size 433
Sequence Data
>SC205683 3'UTR clone of NM_015941
The sequence shown below is from the reference sequence of NM_015941. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCCAGTCCGAGCAGCCCCAGACCGCTGCCGCCCGAAGCTAAGCCTGCCTCTGGCCTTCCCCTCCGCCTC
AATGCAGAACCAGTAGTGGGAGCACTGTGTTTAGAGTTAAGAGTGAACACTGTTTGATTTTACTTGGAAT
TTCCTCTGTTATATAGCTTTTCCCAATGCTAATTTCCAAACAACAACAACAAAATAACATGTTTGCCTGT
TAAGTTGTATAAAAGTAGGTGATTCTGTATTTAAAGAAAATATTACTGTTACATATACTGCTTGCAATTT
CTGTATTTATTGTTCTCTGGAAATAAATATAGTTATTAAAGGATTCTCACTCCAAACATGGCCTCTCTCT
TTACTTGGACTTTGAACAAAAGTCAACTGTTGTCTCTTTTCAAACCAAATTGGGAGAATTGTTGCAAAGT
AGTGAATGGCAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015941.2
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Locus ID 51606

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.