COPS6 (NM_006833) Human 3' UTR Clone

CAT#: SC205751

3`UTR clone of COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COPS6
• Synonyms: CSN6; MOV34-34KD
• ACCN: NM_006833
• Insert Size: 416
• Sequence Data:
  Insert Sequence

  >SC205751 3'UTR clone of NM_006833
  The sequence shown below is from the reference sequence of NM_006833. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGGCATCGGCAGGAGAATGCGCGGGCTCTTTTTCTGATGAGGGTACTTGAAGGGCTGATGGACAGGGGT
  CAGGCAACTATCCCAAAGGGGAGGGCACTACACTTCCTTGAGAGAAACCGCTGTCATTAATAAAAGGGGA
  GCAGCCCCTGAGCACCCCTGCTGGTGGCTCTGTCCTCTGTTAGGCACCACACTGGTTGGTCAACTTGGAT
  GTTCATCGAGGCTCATTCTGGCCTTGCTCAGAAGCCCTTCTGATGCTCTTCAGTGAGGGAGGCACTACCA
  TTTGAAGTGACCCCATGTCAGTCACATGGACTGGTCTTTAGCAAAGTCCAAGGCTGCCTGCTTCCACCTA
  AGTGGTCTCTGTTCTACACTTTAATGTCACCCTCTACATCATCTTACCTAGCCCACCCAACCTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006833.4
• Summary: The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
• Locus ID: 10980