GABA A Receptor beta 1 (GABRB1) (NM_000812) Human 3' UTR Clone

CAT#: SC205757

3`UTR clone of gamma-aminobutyric acid (GABA) A receptor beta 1 (GABRB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GABRB1
• Synonyms: EIEE45
• ACCN: NM_000812
• Insert Size: 423 bp
• Sequence Data:
  Insert Sequence

  >SC205757 3'UTR clone of NM_000812
  The sequence shown below is from the reference sequence of NM_000812. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATGTCGTCTATTGGCTTTACTATGTACACTGAGGTCTGTTCTAATGGTTCCATTTAGACTACTTTCCTC
  TTCTATTGTTTTTTAACCTTACAGGTCCCCAACAGCGATACTGCTGTTTCTCGAGGTAAGAGATTCAGCC
  ATCCAATTGGTTTTAGGTCTTGCATATCAGTTTTATTACTGCACCATGTTTACTTCAAAAAGACAAAACA
  AAAAAAAAATTATTTTTCCAGTCTACCGTGGTCCAGGTTATCAGCTCTTTAAGAGCTCTATTAATTGCCA
  TGTTTACAAACAAACACAAAGAGAGAAGTTAGACAGGTAGATCTTTAGCAGTCTTTTCTAGTTTCCCTGG
  ATTTCACTGATTTATTTTTTAGGGAAAATGAAAAGAGGACCTTGCTGTCCGCCTGCACTGCTTCCTGGTA
  AAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000812.3
• Summary: 'The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]'
• Locus ID: 2560