Carboxypeptidase B2 (CPB2) (NM_001872) Human 3' UTR Clone

CAT#: SC205765

3`UTR clone of carboxypeptidase B2 (plasma) (CPB2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CPB2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CPB2
Synonyms CPU; PCPB; TAFI
ACCN NM_001872
Insert Size 466
Sequence Data
>SC205765 3'UTR clone of NM_001872
The sequence shown below is from the reference sequence of NM_001872. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCGCTGTCTCTAAAATAGCTTGGCATGTCATTAGGAATGTTTAATGCCCCTGATTTTATCATTCTGCTT
CCGTATTTTAATTTACTGATTCCAGCAAGACCAAATCATTGTATCAAATTATTTTTAAGTTTTATCCGTA
GTTTTGATAAAAGATTTTCCTATTCCTTGGTTCTGTCAGAGAACCTAATAAGTGCTACTTTGCCATTAAG
GCAGACTAGGGTTCATGTCTTTTTACCCTTTAAAAAAAATTGTAAAAGTCTAGTTACCTACTTTTTCTTT
GATTTTCGACGTTTGACTAGCCATCTCAAGCAAGTTTCGACGTTTGACTAGCCATCTCAAGCAAGTTTAA
TCAATGATCATCTCACGCTGATCATTGGATCCTACTCAACAAAAGGAAGGGTGGTCAGAAGTACATTAAA
GATTTCTGCTCCAAATTTTCAATAAATTTCTGCTTGTGCCTTTAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001872.3
Summary Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Locus ID 1361

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.