HSD11B1 (NM_005525) Human 3' UTR Clone

CAT#: SC205789

3`UTR clone of hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD11B1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSD11B1
Synonyms 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
ACCN NM_005525
Insert Size 429 bp
Sequence Data
>SC205789 3'UTR clone of NM_005525
The sequence shown below is from the reference sequence of NM_005525. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACAGATTCATAAACAAGTAGGAACTCCCTGAGGGCTGGGCATGCTGAGGGATTTTGGGACTGTTCTGTC
TCATGTTTATCTGAGCTCTTATCTATGAAGACATCTTCCCAGAGTGTCCCCAGAGACATGCAAGTCATGG
GTCACACCTGACAAATGGAAGGAGTTCCTCTAACATTTGCAAAATGGAAATGTAATAATAATGAATGTCA
TGCACCGCTGCAGCCAGCAGTTGTAAAATTGTTAGTAAACATAGGTATAATTACCAGATAGTTATATTAA
ATTTATATCTTATATATAATAATATGTGATGATTAATACAATATTAATTATAATAAAGGTCACATAAACT
TTATAAATTCATAACTGGTAGCTATAACTTGAGCTTATTCAGGATGGTTTCTTTAAAACCATAAACTGTA
CAAATGAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005525.2
Summary 'The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]'
Locus ID 3290

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.