PTS (NM_000317) Human 3' UTR Clone

CAT#: SC205815

3`UTR clone of 6-pyruvoyltetrahydropterin synthase (PTS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTS
• Synonyms: PTPS
• ACCN: NM_000317
• Insert Size: 436 bp
• Sequence Data:
  Insert Sequence

  >SC205815 3'UTR clone of NM_000317
  The sequence shown below is from the reference sequence of NM_000317. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGTATACGAAACTGACAATAATATTGTGGTTTATAAAGGAGAATAGCTATTGGGGTTAGCATTGCACAA
  AGCCCAGTTTCTTTCTGTGTTTGAAAAAGATTTTGATCCCCTTGGAATATTAAGAGGTCAACACGTGATT
  GTTGTACGTACACATTGTGCTCTGGAGTGCCTATTTATTGAAATCATTGTAAGACCTGTTATAAATTTAA
  GTCTATTTAAAACTAAACTTGTAATATACATCCTGAAAATCATTTAGAGAGTCTTTTATTTATAAATTAA
  AAATCACTTCATTTTCACAAAATGTTTTGGTGTGGGATTATTTGAAAGCAAAAGAAATCTAATTTTGTTT
  TCTCCATTACCTCATTTTAGTATTAATTTTTACTTGGTATAATATACATGGTTAAAATGCTTATGTGACT
  TCGAGTAGGTGAATCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000317.2
• Summary: 'The enzyme encoded by this gene catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. [provided by RefSeq, Oct 2008]'
• Locus ID: 5805