CD18 (ITGB2) (NM_000211) Human 3' UTR Clone

CAT#: SC205864

3`UTR clone of integrin beta 2 (complement component 3 receptor 3 and 4 subunit) (ITGB2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITGB2
• Synonyms: CD18; LAD; LCAMB; LFA-1; MAC-1; MF17; MFI7
• ACCN: NM_000211
• Insert Size: 433 bp
• Sequence Data:
  Insert Sequence

  >SC205864 3'UTR clone of NM_000211
  The sequence shown below is from the reference sequence of NM_000211. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCCCAAGTTTGCTGAGAGTTAGGAGCACTTGGTGAAGACAAGGCCGTCAGGACCCACCATGTCTGCCCC
  ATCACGCGGCCGAGACATGGCTTGCCACAGCTCTTGAGGATGTCACCAATTAACCAGAAATCCAGTTATT
  TTCCGCCCTCAAAATGACAGCCATGGCCGGCCGGGTGCTTCTGGGGGCTCGTCGGGGGGACAGCTCCACT
  CTGACTGGCACAGTCTTTGCATGGAGACTTGAGGAGGGAGGGCTTGAGGTTGGTGAGGTTAGGTGCGTGT
  TTCCTGTGCAAGTCAGGACATCAGTCTGATTAAAGGTGGTGCCAATTTATTTACATTTAAACTTGTCAGG
  GTATAAAATGACATCCCATTAATTATATTGTTAATCAATCACGTGTATAGAAAAAAAATAAAACTTCAAT
  ACAGGCTGTCCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000211.3
• Summary: 'This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]'
• Locus ID: 3689