HSD3B2 (NM_000198) Human 3' UTR Clone

CAT#: SC205920

3`UTR clone of hydroxy-delta-5-steroid dehydrogenase 3 beta- and steroid delta-isomerase 2 (HSD3B2) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD3B2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSD3B2
Synonyms HSD3B; HSDB; SDR11E2
ACCN NM_000198
Insert Size 422 bp
Sequence Data
>SC205920 3'UTR clone of NM_000198
The sequence shown below is from the reference sequence of NM_000198. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CACAAGGAGACCCTGAAGTCCAAGACTCAGTGATTTAAGGATGACAGAGATGTGCATGTGGGTATTGTTA
GGAAATGTCATCAAACTCCACCCACCTGGCTTCATACAGAAGGCAACAGGGGCACAAGCCCAGGTCCTGC
TGCCTCTCTTTCACACAATGCCCAACTTACTGTCTTCTTCATGTCATCAAAATCTGCACAGTCACTGGCC
CAACCAGAACTTTCTGTCCTAATCATACACCAGAAGACAAACAATATGATTTGCTGTTACCAAATCTCAG
TGGCTGATTCTGAACAATTGTGGTCTCTCTTAACTTGAGGTTCTCTTTTGACTAATAGAGCTCCATTTCC
CCTCTTAAATGAGAAAGCATTTCTTTTCTCTTTAATCTCCTATTCCTTCACACAGTTCAACATAAAGAGC
AA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000198.3
Summary 'The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]'
Locus ID 3284

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.