GCDH (NM_000159) Human 3' UTR Clone

CAT#: SC206001

3`UTR clone of glutaryl-Coenzyme A dehydrogenase (GCDH) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GCDH
• Synonyms: ACAD5; GCD
• ACCN: NM_000159
• Insert Size: 443 bp
• Sequence Data:
  Insert Sequence

  >SC206001 3'UTR clone of NM_000159
  The sequence shown below is from the reference sequence of NM_000159. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGAGCTATCACGGGAATCCAGGCGTTCACGGCCAGCAAGTGAGCCGCTCCATCAGGGGCCCGAAACTC
  TCAAGCCCCTTTCTGGAGAGATGCCTGGCTGGACCGTAGGAGCGCTGTGCTCTGAGCTTAGAAAGGGAGG
  TGGCGGATGGAGTGGGAAGTGAGAGACACTGATTTTTAAATATCAAAATTTCCCTTCTGAAGTCGTTCAG
  ATGTGTTCCTTAAAAAGAAGATGGAATTCTCTGTAGAGCGTCTCAATCCACTTTTAACCATGGATGAGAG
  CAGACTCCATTTACCCTGAAATAGCAGCTTCTCTTGAGAGGAGAGTGACATGGAAGCAACTCCGTCTGCT
  GCAGCTGACCCCCTCACACTGAGTTCACAGTGCGCCCTCCCTCCCTCCCATCTGGGGGTAGTGCCTTATG
  CTGGGTGTTGGAGCAGAGTGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000159.2
• Summary: The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
• Locus ID: 2639