TRK fused gene (TFG) (NM_001007565) Human 3' UTR Clone

CAT#: SC206024

3`UTR clone of TRK-fused gene (TFG) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TFG
• Synonyms: HMSNP; SPG57; TF6; TRKT3
• ACCN: NM_001007565
• Insert Size: 457
• Sequence Data:
  Insert Sequence

  >SC206024 3'UTR clone of NM_001007565
  The sequence shown below is from the reference sequence of NM_001007565. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTTGGTCAGGGCTATACCCAACCTGGACCTGGTTATCGATAAGGAGGCTCCTCTACACCAATTAATGT
  AGCTGCTAGCTATTGGCCTCCCAAAAGACTCCAGTACTATTTTAATTTGTATTGAAGAAGTTCAGAAATT
  TAAAAGCAGAGCATTTTTTATGATATCATTGTTGGTGTTAATTGAAAGTATAATTTGCTGGAACACAAAG
  ACCAAAATGAAAGTTTTTTCCTCCCTGCTTAAAAATGTAGCAGCTTCTTAGTTACTTTGGAACACTACTC
  TTACATGTATAAAGTGATTGACTTGACTTTCTAGCTTCCCTTGTCCGGAGGATATTAAAATGCTAGGGTG
  AGGTTTAGCCATCTTACTTGGCTTTTTACTATTAACATGATGTACTAAAGTAGAGCCCTTTGAGAATACA
  AGATATTATGTATAAAATGTAACACTGATGATAGGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001007565.1
• Summary: There are several documented fusion oncoproteins encoded partially by this gene. This gene also participates in several oncogenic rearrangements resulting in anaplastic lymphoma and mixoid chondrosarcoma, and may play a role in the NF-kappaB pathway. Multiple transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
• Locus ID: 10342