EPHX2 (NM_001979) Human 3' UTR Clone

CAT#: SC206040

3`UTR clone of epoxide hydrolase 2 cytoplasmic (EPHX2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPHX2
• Synonyms: ABHD20; CEH; SEH
• ACCN: NM_001979
• Insert Size: 488 bp
• Sequence Data:
  Insert Sequence

  >SC206040 3'UTR clone of NM_001979
  The sequence shown below is from the reference sequence of NM_001979. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCTGGATTCTGATGCCCGGAACCCACCGGTGGTCTCAAAGATGTAGAACGCAGCGTGTGCCCACGCTCA
  GCAGGTGTGCCATCCTTCCACCTGCTGGGGCACCATTCTTAGTATACAGAGGTGGCCTTACACACATCTT
  GCATGGATGGCAGCATTGTTCTGAAGGGGTTTGCAGAAAAAAAAGATTTTCTTTACATAAAGTGAATCAA
  ATTTGACATTATTTTAGATCCCAGAGAAATCAGGTGTGATTAGTTCTCCAGGCATGAATGCATCGTCCCT
  TTATCTGTAAGAACCCTTAGTGTCCTGTAGGGGGACAGAATGGGGTGGCCAGGTGGTGATTTCTCTTTGA
  CCAATGCATAGTTTGGCAGAAAAATCAGCCGTTCATTTAGAAGAATCTTAGCAGAGATTGGGATGCCTTA
  CTCAATAAAGCTAAGATGACTATGCTGCTGGCTGTCTTTGTTCTTGGAGAGGTGGAGTGACTGTTCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001979.4
• Summary: 'This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]'
• Locus ID: 2053