NDUFA4 (NM_002489) Human 3' UTR Clone

CAT#: SC206056

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex4 9kDa (NDUFA4) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFA4
• Synonyms: CI-9k; CI-MLRQ; COXFA4; MLRQ
• ACCN: NM_002489
• Insert Size: 456 bp
• Sequence Data:
  Insert Sequence

  >SC206056 3'UTR clone of NM_002489
  The sequence shown below is from the reference sequence of NM_002489. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAGCTGAAGAAGGAACGTCCAGATTTCTAAATGAAATGTTTCACTATAACGCTGCTTTAGAATGAAGG
  TCTTCCAGAAGCCACATCCGCACAATTTTCCACTTAACCAGGAAATATTTCTCCTCTAAATGCATGAAAT
  CATGTTGGAGATCTCTATTGTAATCTCTATTGGAGATTACAATGATTAAATCAATAAATAACTGAAACTT
  GATATGTGTCACTTTTTTATGCTGAAAGTATGCTCTGAACTTTAGAGTATAGGAAATTAACTATTAGAAT
  TTAAAGAATTTCTTGAATTTCTGTAGTTTGAAAATACGACTTTAAGCTGCTTTAGTAAAACACTTCCATT
  TTGTGTATAGACTGTTGGTAACTTCACTAGAGCATACATAACAACTGGAACTGGAAATTATACAAAAGTA
  AATTGGGAAGGATACTCCAGCATCTGACACTGGCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002489.2
• Summary: 'The protein encoded by this gene belongs to the complex I 9kDa subunit family. Mammalian complex I of mitochondrial respiratory chain is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]'
• Locus ID: 4697