CD9 (NM_001769) Human 3' UTR Clone

CAT#: SC206058

3`UTR clone of CD9 molecule (CD9) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CD9
Synonyms BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29
ACCN NM_001769
Insert Size 443 bp
Sequence Data
>SC206058 3'UTR clone of NM_001769
The sequence shown below is from the reference sequence of NM_001769. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGTGCTATCCGCAGGAACCGCGAGATGGTCTAGAGTCAGCTTACATCCCTGAGCAGGAAAGTTTACCCA
TGAAGATTGGTGGGATTTTTTGTTTGTTTGTTTTGTTTTGTTTGTTGTTTGTTGTTTGTTTTTTTGCCAC
TAATTTTAGTATTCATTCTGCATTGCTAGATAAAAGCTGAAGTTACTTTATGTTTGTCTTTTAATGCTTC
ATTCAATATTGACATTTGTAGTTGAGCGGGGGGTTTGGTTTGCTTTGGTTTATATTTTTTCAGTTGTTTG
TTTTTGCTTGTTATATTAAGCAGAAATCCTGCAATGAAAGGTACTATATTTGCTAGACTCTAGACAAGAT
ATTGTACATAAAAGAATTTTTTTGTCTTTAAATAGATACAAATGTCTATCAACTTTAATCAAGTTGTAAC
TTATATTGAAGACAATTTGATAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001769.2
Summary 'This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]'
Locus ID 928

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.