DHRS3 (NM_004753) Human 3' UTR Clone

CAT#: SC206070

3`UTR clone of dehydrogenase/reductase (SDR family) member 3 (DHRS3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DHRS3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DHRS3
Synonyms DD83.1; RDH17; retSDR1; Rsdr1; SDR1; SDR16C1
ACCN NM_004753
Insert Size 447
Sequence Data
>SC206070 3'UTR clone of NM_004753
The sequence shown below is from the reference sequence of NM_004753. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGAACCTACACCTGCATGAACACTTTCAAAGGGCGGACATAGAGACAGGATGAAGACATGCTTGAGGAG
CCACGGAGTTTGGGGGCCACAGCACCTGGGCACACACCCGAGCACCTGTCCATTGGCATGCTTCTGCTGG
GTGAGCAGGACAGCTCCTGTCCCCAGCGAAGAATCCGGCTGCCCCTGGGCCAGTCCCAGGACCTTTGCAC
AGGACTGATGGGTATAACTGACCCCCACAGGGAGGCAGGAAAACAGCCAGAAGCCACCTTGACACTTTTG
AACATTTCCAGTTCTGTAGAGTTTATTGTCAATTGCTTCTCAAGTCTAACCAGCCTCAGCAGTGTGCATA
GACCATTTCCAGGAGGGTCTGTCCCCAGATGCTCTGCCTCCCGTTCCAAAACCCACTCATCCTCAGCTTG
CACAAACTGGTTGAACGGCAGGAATGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004753.4
Summary Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]). [supplied by OMIM, Jun 2009]
Locus ID 9249

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.