THOC3 (NM_032361) Human 3' UTR Clone

CAT#: SC206107

3`UTR clone of THO complex 3 (THOC3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "THOC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol THOC3
Synonyms hTREX45; THO3
ACCN NM_032361
Insert Size 475
Sequence Data
>SC206107 3'UTR clone of NM_032361
The sequence shown below is from the reference sequence of NM_032361. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAACTGTGAAGCTGTTTGGGCTTCCTAATGATTCTTGAGAGGAGGTTGTAGGGAGAGGAGGCCCCGGCA
GAGGTCTTCCTTCATGTGGTTAGTTTGGTCTGTTCTCTCGGAGTTGGTGGGCACCCTAAATATTTGTAAG
TTGGTATAAATTGTAAACGTCTCTGGTCAGGCTGCGCATTTCATTCTTTTGCTTTGTCTGTGTATTAGCT
CTTTCCATTCTTTGCCCCCAGCATGAGTTAACTCGCGTGGACTCTGCAGTGCGAGTAGTGACCCCACCAT
ACCTTGTCCTCTGGACCTCCTGTCTTCTCTGCTTCTGGGTGCATGGTAGACTTTGTGGCATTTGATACAA
CTTGGACAATACCTAGTTTGGAGGGAGGGGAATGGAAGGGCATGGAAGTTTTTTTAAATAATTAAAAATA
TATATATATAATTTTGAGAATTGAGCATTTAATAAACTGACTTTTGTTATTATGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032361.2
Summary This gene encodes a component of the nuclear THO transcription elongation complex, which is part of the larger transcription export (TREX) complex that couples messenger RNA processing and export. In humans, the transcription export complex is recruited to the 5'-end of messenger RNAs in a splicing- and cap-dependent manner. Studies of a related complex in mouse suggest that the metazoan transcription export complex is involved in cell differentiation and development. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, May 2013]
Locus ID 84321

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.