PABP (PABPC1) (NM_002568) Human 3' UTR Clone

CAT#: SC206129

3`UTR clone of poly(A) binding protein cytoplasmic 1 (PABPC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PABPC1
• Synonyms: PAB1; PABP; PABP1; PABPC2; PABPL1
• ACCN: NM_002568
• Insert Size: 475
• Sequence Data:
  Insert Sequence

  >SC206129 3'UTR clone of NM_002568
  The sequence shown below is from the reference sequence of NM_002568. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAGTTAACAGTGCCACCGGTGTTCCAACTGTTTAAAATTGATCAGGGACCATGAAAAGAAACTTGTGC
  TTCACCGAAGAAAAATATCTAAACATCGAAAAACTTAAATATTATGGAAAAAAAACATTGCAAAATATAA
  AATAAATAAAAAAAGGAAAGGAAACTTTGAACCTTATGTACCGAGCAAATGCCAGGTCTAGCAAACATAA
  TGCTAGTCCTAGATTACTTATTGATTTAAAAACAAAAAAACACAAAAAAATAGTAAAATATAAAAACAAA
  TTAATGTTTTATAGACCCTGGGAAAAAGAATTTTCAGCAAAGTACAAAAATTTAAAGCATTCCTTTCTTT
  AATTTTGTAATTCTTTACTGTGGAATAGCTCAGAATGTCAGTTCTGTTTTAAGTAACAGAATTGATAACT
  GAGCAAGGAAACGTAATTTGGATTATAAAATTCTTGCTTTAATAAAAATTCCTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002568.3
• Summary: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes. [provided by RefSeq, Aug 2010]
• Locus ID: 26986