TAP2 (NM_018833) Human 3' UTR Clone

CAT#: SC206148

3`UTR clone of transporter 2 ATP-binding cassette sub-family B (MDR/TAP) (TAP2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAP2
• Synonyms: ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11
• ACCN: NM_018833
• Insert Size: 469 bp
• Sequence Data:
  Insert Sequence

  >SC206148 3'UTR clone of NM_018833
  The sequence shown below is from the reference sequence of NM_018833. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAAAACCCTTTGGAAGTTCATGATATTTTGAATTTCAATGGATATTTCCTGGGAATAATGAGTTCAAAT
  GAACGAATATGTGGAACAAAGCATCACCAACATTTATTTTTTCAGGATGAGGTGATGGACAAAACCATCA
  CAGGGAAATTGAGGCAAATAGTACATGTAAAACAATACTTCGGGTGAGTCCACCTATCCCAAAGTCGTAT
  CAAAGAAGTGGCTGCAGATTGGAGCCCAAAGCCTTTGGTTCCTCAGTTTCCAAATGGATTCTCACTAGGT
  GGGATCATGAGTTTGCTTTGGACACCCCAAATTCTAACTATTTCTTTTGTTTCTTACATCCTTTCCCTCT
  TCCCCAGCCCCTTCCCCTCATGTTACACCTCTTGCTGGTTTGAGACGTCAATCACCACTGAGAAAGAATT
  AAACCAGTATTTTGAGCTGGCAAAATTCTTAGCCTAGTACAATTCCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_018833.2
• Summary: 'The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Feb 2014]'
• Locus ID: 6891