UGT2B17 (NM_001077) Human 3' UTR Clone

CAT#: SC206242

3`UTR clone of UDP glucuronosyltransferase 2 family polypeptide B17 (UGT2B17) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT2B17
• Synonyms: BMND12; UDPGT2B17
• ACCN: NM_001077
• Insert Size: 476 bp
• Sequence Data:
  Insert Sequence

  >SC206242 3'UTR clone of NM_001077
  The sequence shown below is from the reference sequence of NM_001077. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGAAAGCTTGCCAAAACAGGAAAGAAGAAGAAAAGGGATTAGTTATATCAAAAGCCTGAAGTGGAATGA
  CCAAAAGATGGGACTCCTCCTTTATTCCAGCATGGAGGGTTTTAAATGGAGGATTTCCTTTTTCCTGCGA
  CAAAACGTCTTTTCACAACTTACCCTGTTAAGTCAAAATTTATTTTCCAGGAATTTAATATGTACTTTAG
  TTGGAATTATTCTATGTCAATGATTTTTAAGCTATGAAAAATAATAATATAAAACCTTATGGGCTTATAT
  TGAAATTTATTATTCTAATCCAAAAGTTACCCCACACAAAAGTTACTGAGCTTCCTTATGTTTCACACAT
  TGTATTTGAACACAAAACATTAACAACTCCACTCATAGTATCAACATTGTTTTGCAAATACTCAGAATAT
  TTTGGCTTCATTTTGAGCAGAATTTTTGTTTTTAATTTTGCCAATGAAATCTTCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001077.3
• Summary: 'This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]'
• Locus ID: 7367