NME4 (NM_005009) Human 3' UTR Clone

CAT#: SC206256

3`UTR clone of non-metastatic cells 4 protein expressed in (NME4) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NME4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NME4
Synonyms NDPK-D; nm23-H4; NM23H4
ACCN NM_005009
Insert Size 414 bp
Sequence Data
>SC206256 3'UTR clone of NM_005009
The sequence shown below is from the reference sequence of NM_005009. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCATCCACCCAGCCTGAGGCTCAAGCTGCCCTTACCACCCCATCCCCCACGCAGGACCAACTACCTCCG
TCAGCAAGAACCCAAGCCCACATCCAAACCTGCCTGTCCCAAACCACTTACTTCCCTGTTCACCTCTGCC
CCACCCCAGCCCAGAGGAGTTTGAGCCACCAACTTCAGTGCCTTTCTGTACCCCAAGCCAGCACAAGATT
GGACCAATCCTTTTTGCACCAAAGTGCCGGACAACCTTTGTGGTGGGGGGGGGTCTTCACATTATCATAA
CCTCTCCTCTAAAGGGGAGGCATTAAAATTCACTGTGCCCAGCACATGGGTGGTACACTAATTATGACTT
CCCCCAGCTCTGAGGTAGAAATGACGCCTTTATGCAAGTTGTAAGGAGTTGAACAGTAAAGAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005009.2
Summary 'The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]'
Locus ID 4833

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.