EPX (NM_000502) Human 3' UTR Clone

CAT#: SC206257

3`UTR clone of eosinophil peroxidase (EPX) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPX
• Synonyms: EPO; EPP; EPX-PEN; EPXD
• ACCN: NM_000502
• Insert Size: 465
• Sequence Data:
  Insert Sequence

  >SC206257 3'UTR clone of NM_000502
  The sequence shown below is from the reference sequence of NM_000502. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGGTTGAACCTATCAGCCTGGCGAGGGACATGAGGCTTCTGCAGGAGTCTATCCCAAGTCTCCAACTT
  TTGGAGACAAGGGGAAGGGGAGGACCATGAGGCTGCCTTGTCTCCCTGGAGCAAGTGCAGGCTGCTGACG
  CTTCTGCTGGCTACAGCTCAGAGCTGGGTTCCCCAGCCAGGAGTGAAGGCTGGGGGCTCCTATCAGCAAT
  GGACCTTCCCGCCTTGGGAGCCTCTTAGGTATTAGGCTATGAATCAGCGCCACGTGCAAAGGCTTGGGAG
  CCAAGCCATGTGGTCTTGCACCCCAGGCAAGAAAAGTCAGCTGGAGGGTTTACAGCACTTTCTACTGTTT
  CCCAGCCCTCCCTCCCCTCCCTCACCATGACTAAGAGACCACTCGGTCCTAGCCTCCAGACACCCCACAA
  TACTCCTCTGAGCCTGAGGCCAGGCAGCATGCTCTGCTTCTACCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000502.4
• Summary: This gene is a member of the peroxidase gene family and is expressed in eosinophils. The encoded preproprotein is proteolytically processed into covalently attached heavy and light chains to form the mature enzyme, which functions as an oxidant. The enzyme is released at sites of parasitic infection or allergen stimulation to mediate lysis of protozoa or parasitic worms. The gene is found in a gene cluster with other peroxidase genes on chromosome 17. Mutations in this gene result in eosinophil peroxidase deficiency. [provided by RefSeq, Feb 2016]
• Locus ID: 8288